View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_23 (Length: 368)
Name: NF19297_low_23
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_23 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 212 - 368
Target Start/End: Complemental strand, 36573460 - 36573304
Alignment:
| Q |
212 |
aaaagagacgggatatattacgatgtcaaaagagacgagttatattacaatatccatcaagcaatgatcccataaccttgccgatttgatgaccggtttg |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573460 |
aaaagagacgggttatattacgatgtcaaaagagacgggttatattataatatccatcaagcaatgatcccataaccttgccgatttgatgaccggtttg |
36573361 |
T |
|
| Q |
312 |
gtttttaaaacatttatatgtcatcttaagactataaaaataaagaaataataatat |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573360 |
gtttttaaaacatttatatgtcatcttaagactataaaaataaagaaataataatat |
36573304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 65 - 131
Target Start/End: Complemental strand, 36573608 - 36573542
Alignment:
| Q |
65 |
cctatattttattcccacatggattataattaaattaaaacaataaacaatgatatattttaactac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573608 |
cctatattttattcccacatggattataattaaattaaaacaataaacaatgatatattttaactac |
36573542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 325
Target Start/End: Complemental strand, 24565545 - 24565511
Alignment:
| Q |
291 |
gccgatttgatgaccggtttggtttttaaaacatt |
325 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24565545 |
gccgattcgatgaccggtttggtttttaaaacatt |
24565511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 36573675 - 36573647
Alignment:
| Q |
19 |
acatagtatgcccctttcaattttgcaat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36573675 |
acatagtatgcccctttcaattttgcaat |
36573647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University