View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_26 (Length: 356)
Name: NF19297_low_26
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 152 - 340
Target Start/End: Complemental strand, 5569894 - 5569706
Alignment:
| Q |
152 |
gtttggctcttttgagcgatcttttgatgtatcttgttttgctttagaatcatggtcatttttggatgaactttgaacaacttatttgcagtctataaca |
251 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5569894 |
gtttgactctttcgagcgatcttttgatgtatcttgttttgctttagaatcatggtcatttttggatgaactttgaacaacttatttgcagtctataaca |
5569795 |
T |
|
| Q |
252 |
caagcacaacacttttcatcataagtgctatgtattaattatttccctgataaaagataaatgaaagctaaattgttttggtataagtt |
340 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5569794 |
caagcacaacacttatcatcataagtgttatgtattagttatttctctggtaaaagataaacgaaagctaaattgttttggtataagtt |
5569706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 5570005 - 5569890
Alignment:
| Q |
13 |
aatataatatcaatgaaaacacaatcaaaatatgtatgaaaaaataattattacnnnnnnnagtgatctttggatgtgtcttatttgagtgggtaattta |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5570005 |
aatataatatcaatgaaaaaacaatcaaaatatgtatgaaaaaataattattactttttttagcgatctttggatgtgtcttatttgattgggtaattta |
5569906 |
T |
|
| Q |
113 |
cgtcagtgtttgtttg |
128 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5569905 |
cgtcagtgtttgtttg |
5569890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University