View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_34 (Length: 315)
Name: NF19297_low_34
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 289
Target Start/End: Original strand, 30403340 - 30403611
Alignment:
| Q |
18 |
aaaattaatcatggttcaccccattaggagcataaggtctgtgagaacaattagacatttctaggcctcacctagttccatatacaattcggaaaataca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30403340 |
aaaattaatcatggttcaccccattaggagcataaggtctgtgagaacaattgaacatttctaggcctcacctagttccatatacaattcggaaaataca |
30403439 |
T |
|
| Q |
118 |
atctgaaaatttagaaaaaactgaaatttgctcttattaatattcactgtttttcgatcaaataagagataatgatttctacctttgttaagattatgtt |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30403440 |
atccgaaaatttagaaaaaactgaaatttgctcttattaatattcactatttttcgatcaaataagagataatgatttctacctttgttaagattatgtt |
30403539 |
T |
|
| Q |
218 |
tttgcatgtattttttcttctgttagataacatacaagagttatctgggagatatgtactgaattgctcgtg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30403540 |
tttgcatgtattttttcttctgttagataacatacaagagttatctgggagatatgtactgaattgttcgtg |
30403611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University