View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_41 (Length: 270)
Name: NF19297_low_41
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_41 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 36572853 - 36573113
Alignment:
| Q |
13 |
cagttttttcaagcttggcagcaaaatatcgtccctaacaactaaaagaaatcccagccttaaaa---gttttttcaaggagtgagatgttggaatccag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
36572853 |
cagttttttcaagcttggcagcaaaatatcgtccctaacaactaaaagaaatcccagccttaaaaccagttttgtcaaggaatgagatgttggaatccag |
36572952 |
T |
 |
| Q |
110 |
cttggaaaagtaacccttgtatcaaagtttttcaaatcatcgttttgaagttgaaggcaattgacgttgcgactgagtactacagatacaattgaagcca |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| || |
|
|
| T |
36572953 |
cttggaaaagtaacccttgtatcaaaaattttcaaatcatcgttttgaagttgaaggcaattgacgttgcgactgagcacagaagatacaattgaagtca |
36573052 |
T |
 |
| Q |
210 |
ctttatacggaccgaaggtgacttttagtatactaataacaatcttcttagtccaattctc |
270 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
36573053 |
ctttataaggaccgaatgtgacttttagtatactaataacaagcttcttaatccaattctc |
36573113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University