View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_59 (Length: 237)
Name: NF19297_low_59
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 46020710 - 46020895
Alignment:
| Q |
1 |
aacaaaacaaccaaacacaagaagcactaagattcttacacaaacttacaactcaaaataaagtcaagtagtggcaaacaaatcaacaattccaggactg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46020710 |
aacaaaacaaccaaacacaagaagcactaagattcttgc-------------tcaaaataaagtcaagtagtggcaaacaaatcaacaattccaggactg |
46020796 |
T |
 |
| Q |
101 |
gtttgttatcaattttggctttaaagagtaaagttaatatcag--caccacattatatttatagtatagaatatcctatggattcttctttttaaggaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46020797 |
gtttgttatcaattttggctttaaagagtaaagttaatatcagcacaccacattatatttatagtatagaatatcctatgga---ttctttttaaggaaa |
46020893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University