View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_62 (Length: 228)
Name: NF19297_low_62
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_62 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 898846 - 899043
Alignment:
| Q |
18 |
aatggaactcatctaatcgttgttgcaccatttttaatgtcgatggtagctatttaggtaaccttatcaaaattattgcactttcttttgtggaatgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898846 |
aatggaactcatctaatcgttgttgcaccatttttaatgtcgatggtagctatttaggtaaccttatcaaaattattgcactttcttttgtggaatgaaa |
898945 |
T |
|
| Q |
118 |
gtattatgacaagacattatcataaaatcacttttagcttttgtcaaataccaagagttttataatcaagaacttattgttccacttctagaattatc |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
898946 |
gtattgtgacaagacattatcataaaatcacttttagcttttgtcaaataccaagagttttataatcaagaacttattgttccacttctataattatc |
899043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University