View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_67 (Length: 221)
Name: NF19297_low_67
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 78 - 204
Target Start/End: Original strand, 3635338 - 3635464
Alignment:
| Q |
78 |
gttgcagaatgtgggaattctctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggtgctgttgaatctgcttc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3635338 |
gttgcagaatgtgggaattctctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggggctgttgaatctgcttc |
3635437 |
T |
 |
| Q |
178 |
cattgcattgtttggtcctttgattgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3635438 |
cattgcattgtttggtcctttgattgg |
3635464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 79 - 195
Target Start/End: Original strand, 3644771 - 3644887
Alignment:
| Q |
79 |
ttgcagaatgtgggaattctctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggtgctgttgaatctgcttcc |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644771 |
ttgcagaatgtgggaattttctgttggtttatatatgatcagtatttggccagactcactgctctatgcagcaatatatggtgctgttgaatctgcttcc |
3644870 |
T |
 |
| Q |
179 |
attgcattgtttggtcc |
195 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3644871 |
attgcattgtttggtcc |
3644887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University