View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_68 (Length: 220)
Name: NF19297_low_68
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 31117385 - 31117190
Alignment:
| Q |
15 |
gaacaaatgatcttgacaacctgattgcgtgaatgtatccttttgctaacggttgtgaattcgagttccttatcccta------gacaatacctgctccg |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||| |
|
|
| T |
31117385 |
gaacaaatgatcttgacaacgtgattgcgtgaatgtatccttttgctaacggttgtgaacttgagttccttatccctatccctagacaatacctgctccg |
31117286 |
T |
 |
| Q |
109 |
atatcaaatctaaaaatttaaaatgatacatctacttccatttcaatactccaccttacctttaaatcgacagtgatgtcactttaatcatcaact |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31117285 |
atatcaaatctaaaaatttaaaatgatacatctacttccattttcatactccaccttacctttaaatcgacagtgatgtcactttaaccatcaact |
31117190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University