View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_71 (Length: 214)
Name: NF19297_low_71
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 48584259 - 48584054
Alignment:
| Q |
1 |
tcccttccactcttcctttccacaacttgaacaaatatgtannnnnnn-ctta-ctttgattgtttgctcaaacaagtttcataattttcttatagtagt |
98 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48584259 |
tcccttcaactcttcctttccacaacttgaacaaatatgtattttttttcttaactttgattgtt-gctcaaacaagtttcataattttcttatagtagt |
48584161 |
T |
|
| Q |
99 |
gtaatgataatattaatctccttaggcaagaataggtttagctagattaaggcacagatcaatattattatcatatttattagatgaaaagcccgtgcgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48584160 |
gtaatgataatattaatctccttaggcaagaataggtttagcttgattaaggcacagatcaatattattatcatatttattagatgaaaagcccgtgcgt |
48584061 |
T |
|
| Q |
199 |
ttcataa |
205 |
Q |
| |
|
||||||| |
|
|
| T |
48584060 |
ttcataa |
48584054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University