View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19299_low_17 (Length: 239)
Name: NF19299_low_17
Description: NF19299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19299_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 33102460 - 33102256
Alignment:
| Q |
1 |
tgttgacctctaggtgttttataattgttttaagtgatgttatgttcatctttgtttgagtaacataaaatttatgcaaccttgttaagtgtgtgaattt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33102460 |
tgttgacctataggtgttttataattgttttaagtgatgttatgtctatctttgtttgagtaacataaaatttatgcaaccttgttaagtgagtgaattt |
33102361 |
T |
 |
| Q |
101 |
cttacattgaactgagtttgtgtcttgaaattcatttggtgcaactaagttgaaaaatagagatcatgatagaactaaatttatttttgtgggaagttta |
200 |
Q |
| |
|
||| ||| |||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
33102360 |
cttgcatggaactgagtttgtgacttgaaagtcatttggtgcaactaagttgaaaaat--agatcataatataactaaatttatttttgtgggaagttta |
33102263 |
T |
 |
| Q |
201 |
tatgacc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
33102262 |
tatgacc |
33102256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University