View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19299_low_4 (Length: 449)
Name: NF19299_low_4
Description: NF19299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19299_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 72 - 430
Target Start/End: Complemental strand, 10000401 - 10000050
Alignment:
| Q |
72 |
gttgaaccggattgaatcggggctgaaccatttcaaccagggttggttgaaccggtatatttgttgcatattttaaccaattaaaccatgactcagaagt |
171 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| | ||||||||||||||| |||| | ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10000401 |
gttgaaccggattgaatcgggactgaaccatttcaacc-gagttggttgaaccggtgtattcgctgcatattttaaccaattaaatcatgactcagaagt |
10000303 |
T |
 |
| Q |
172 |
ttcactggttcgatctc--gtccactttttaaaacattgaccaaccaatacaacagataaatatttgctgttacatatatggaaggcacaagagtacata |
269 |
Q |
| |
|
||||| ||||| ||||| |||| ||||||||| |||||||||| |||||||||||| |||| |||||||||||||||| | || |||||||| |
|
|
| T |
10000302 |
ttcaccggttctatctcttgtccgctttttaaaccattgaccaa----tacaacagataa----ttgcagttacatatatggaagtcgtaaaagtacata |
10000211 |
T |
 |
| Q |
270 |
attttcataatacattcatccatgtttatctatgatttcgcataatcgtctaattggttatttacagtgcaagaggatggttttcgagtatggaccatta |
369 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10000210 |
attttctcaatacattcattcatgtttatctatgatttcacataatcgtctaattgtttatttacagtgcaagaggatggttttcgagtatggaccattg |
10000111 |
T |
 |
| Q |
370 |
attctagtcaatgcagagaagtacctgaagaaagcagatatatgcactacattacatgcct |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10000110 |
attctagtcaatgcagagaagtacctgaagaaagcagatatatgcactacactacatgcct |
10000050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University