View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1929_high_13 (Length: 356)
Name: NF1929_high_13
Description: NF1929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1929_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 19 - 323
Target Start/End: Complemental strand, 40518287 - 40517983
Alignment:
| Q |
19 |
tcaaactagcaagggagaaattacggacatgggatgatcctggcatattatcatcaatatatatgcgcacgttagattatttaattttcaattgtataag |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40518287 |
tcaaactagcaagggaaaaattacggacatgggatgatcctggcatattatcatcaatatatatgcgcacattagattatttaattttcaattgtataag |
40518188 |
T |
|
| Q |
119 |
atagttcgggtctcatctattttaactagttatggaaccagatttaactactagtcgtgagaggaatttttcatggtatattataactctatccaactcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40518187 |
atagttcgggtctcatctattttaactagttatggaaccagatttaactactagtcgtgagaggaatttttcatcgtatattataactctatccaactcg |
40518088 |
T |
|
| Q |
219 |
agatattagtatttatagatgcaggagagcatatcctatttcgtaaattatagtattaaggaggaattaattcattggctgcggatgataaaggcaaggc |
318 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518087 |
agatattagtatttatagatgcaagagagcatatcctatttcgtaaattatagtattaaggaggaattaattcattggctgcggatgataaaggcaaggc |
40517988 |
T |
|
| Q |
319 |
aatta |
323 |
Q |
| |
|
||||| |
|
|
| T |
40517987 |
aatta |
40517983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University