View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1929_high_16 (Length: 335)
Name: NF1929_high_16
Description: NF1929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1929_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 20 - 302
Target Start/End: Original strand, 49768323 - 49768606
Alignment:
| Q |
20 |
ctatagagattgatatcaacaaacttggaccactgcagagaaagaatttagtggagagacttgtcaagattgccgaggaagataatgagaagttcttgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49768323 |
ctatagagattgatatcaacaaacttggaccactgcagaggaagaatttagtggagagacttgtcaagattgccgaggaagataatgagaagttcttgtt |
49768422 |
T |
|
| Q |
120 |
gaagttaagacaacgcattgatcggtatgtatgccaccaacctatctagcaccgacatttcaaattgaatgcatgtttattgcgtagattaagataggac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49768423 |
gaagttaagacaacgcattgatcggtatgtatgctaccaacttatctagcaccgacatttcaaattgaatgcatgtttattgcgttgattaagataggac |
49768522 |
T |
|
| Q |
220 |
attttcttaaattataaacaaattccgtgtctgtgtaaatgtttc-aacgcagtactaacttgagttgttgttttgtgtctgtg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49768523 |
attttcttaaattataaacaaattccgtgtctgtgtaaatgtttctaacgcagtactaacttgagttgttgttttgtgtctgtg |
49768606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 270 - 301
Target Start/End: Complemental strand, 3829667 - 3829636
Alignment:
| Q |
270 |
agtactaacttgagttgttgttttgtgtctgt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3829667 |
agtactaacttgagttgttgttttgtgtctgt |
3829636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University