View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1929_high_17 (Length: 330)
Name: NF1929_high_17
Description: NF1929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1929_high_17 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 330
Target Start/End: Complemental strand, 13254097 - 13253771
Alignment:
| Q |
9 |
caaaggaaaaatattgaccaagttgttacatgtccactatccctatgtatgcattataaactttgaccaagtttaatggattgttagttggggatgcaaa |
108 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13254097 |
caaagaaaaaatattgacaaagttgttacatgtccactatccctatgtatgcattataaacattgaccaagtttaatggattgttagttggggatgcaaa |
13253998 |
T |
|
| Q |
109 |
acaaccgcttcttagagaagcatctttagcttcctggaaatgtctaaaaagttgggataatgcctacttctattatatgggatgatgtttcttcttcacg |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13253997 |
acaactgcttcttagagaagcatctttagcttcctggaaatgtctaaaaagttgggataatg-ctacttctgttatatgggatgatgtttcttcttcacg |
13253899 |
T |
|
| Q |
209 |
tggttttgatttgtaaatccaatag-----nnnnnnnnnnngaaggattgtaaatccaatagttttattttagt-nnnnnnntttctcatgtttaatttc |
302 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13253898 |
tggttttgatttgtaaatccaatagtttttttttttttttttaaggattgtaagtccaatagttttattttagtaaaaaaaaattctcatgtttaatttc |
13253799 |
T |
|
| Q |
303 |
ctttgcaatgtaccaattgaaaaggaaa |
330 |
Q |
| |
|
|||| |||||| |||||||||||||||| |
|
|
| T |
13253798 |
ctttacaatgtcccaattgaaaaggaaa |
13253771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University