View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1929_low_15 (Length: 341)
Name: NF1929_low_15
Description: NF1929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1929_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 341
Target Start/End: Complemental strand, 39088150 - 39087844
Alignment:
| Q |
17 |
aggtgttttttgggtcacatgcaaaagggtcacgtgcttcactactcattaagagaaggagaaatgcaatggtgatgaggatcgaatccattttggaaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39088150 |
aggtgttttttgggtcacatgcaaaagggtcacgtgcttcactactcattaagagaaggagaaatacaatggtgatgaggatcgaatccattttggaaag |
39088051 |
T |
 |
| Q |
117 |
acaagaaaatgaatgtataggttttggttttggtgggttgacaagttatggaatggatggaacaatttatataggtgtggcatgatgtttctaaagccac |
216 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088050 |
acaagaaaatgaatgtata----------------------caagttatggaatggatggaacaatttatataggtgtggcatgatgtttctaaagccac |
39087973 |
T |
 |
| Q |
217 |
tgttcgatattgttaagttgtaataatggata----gagttagctattggtggaccctttttgatgatttgattttacattatataatttcttttttagt |
312 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39087972 |
tgttcgatgttgttaagttgtaataatggatatatagagttagctattagtggaccctttttggtgatttgattttacattatataatttcttttttagt |
39087873 |
T |
 |
| Q |
313 |
aacaaaatgaagcaacttactttgctgtt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39087872 |
aacaaaatgaagcaacttactttgctgtt |
39087844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University