View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1929_low_18 (Length: 328)
Name: NF1929_low_18
Description: NF1929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1929_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 7896485 - 7896175
Alignment:
| Q |
1 |
tacaggcaaatgcatgtgtatggcagaaaccgcagcagggtcgtttcaaatgcaacattgacgccgctttttcctcggtgtggaaccgtaacggtattgg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
7896485 |
tacaggaaaatgcatgtgtatggcagaaaccgcagcagggtcgtttcaaatgcaacattgacgccactttttcctcg-tgtggaaccgtacgggtattgg |
7896387 |
T |
|
| Q |
101 |
tgtttgtttgcgtgatgacaacggtacgtatgtacttgcgcaaacaaggagatttcccacacaacttgctgttgatgttggagaagccatggggctgttt |
200 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896386 |
tgtttgtttgtgtgatgacaacggcacgtatgtacttgcgcaaacaaggagatttcccacacaacttgctgttgatgttggagaagccatggggctgttt |
7896287 |
T |
|
| Q |
201 |
catgccattcaatggttaacagacatgaaatttgataatgtggactttgtgaccgattccaaagtaacagcagaagctttcaattcaccacgaaacgatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7896286 |
catgccattcaatggttaacagacatgaaatttgataatgtggactttgtgaccgattccaaagtaacagcagaagctttcaattcaccacgaaacgacg |
7896187 |
T |
|
| Q |
301 |
taatggagtttg |
312 |
Q |
| |
|
||| |||||||| |
|
|
| T |
7896186 |
taacggagtttg |
7896175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 231 - 270
Target Start/End: Original strand, 8565885 - 8565924
Alignment:
| Q |
231 |
tttgataatgtggactttgtgaccgattccaaagtaacag |
270 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
8565885 |
tttgataatgtggactttgtgtctgattccaaagtaacag |
8565924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 270
Target Start/End: Complemental strand, 8119067 - 8119029
Alignment:
| Q |
232 |
ttgataatgtggactttgtgaccgattccaaagtaacag |
270 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
8119067 |
ttgataatgtggattttgtgactgattccaaagtaacag |
8119029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University