View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1929_low_29 (Length: 226)
Name: NF1929_low_29
Description: NF1929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1929_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 39087830 - 39087687
Alignment:
| Q |
1 |
aattaagttggtgattaacaaaaaattaacaaccgatcgatggaatgtacctgccgtatgcacnnnnnnnatttgcaagtatcttttcttttccaatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39087830 |
aattaagttggtgattaacaaaaaattaacaaccgatcgatggaatgtacctgccgtatgcactttttt-atttgcaagtatcttttcttttccaatttt |
39087732 |
T |
 |
| Q |
101 |
gttaaaacagtaaaaatccacatcacagcaaacaaatattattgg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39087731 |
gttaaaacagtaaaaatccacatcacagcaaacaaatattattgg |
39087687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 161 - 214
Target Start/End: Complemental strand, 39087661 - 39087609
Alignment:
| Q |
161 |
ttctatcatattagatttttactttgaaccaacacttcatcacaagctgatttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
39087661 |
ttctatcatattagatttttactttgaa-caacacttcatcgcaagctgatttt |
39087609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University