View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19300_low_4 (Length: 242)

Name: NF19300_low_4
Description: NF19300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19300_low_4
NF19300_low_4
[»] chr7 (1 HSPs)
chr7 (11-226)||(25772106-25772320)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 25772320 - 25772106
Alignment:
11 tagaaaaggttaccctatccaaaagtgggccacaaccacagtgtgtctgccgcttgattagaaaaataatccatcaccgcccgcctaacctcggttggag 110  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||    
25772320 tagaaaaggttacgctatccaaaagtgggccacaaccacagtgtgtctgccacttgattagaaaaataatccatcaccgcccgcctaacctaggttggag 25772221  T
111 actccacccaaacannnnnnnaccttaagttcactatagggagggcaaccaagttgccaatgctctggctatggacaaagcctacctccttttgcctcac 210  Q
    ||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||     
25772220 actccacccaaaca-ccccccaccttaagttcactatagggagggcaaccaagttgccaatgctcaggctatggacaaagcgtacctccttttgcctcaa 25772122  T
211 agtggtgggattcccc 226  Q
    ||||||||||||||||    
25772121 agtggtgggattcccc 25772106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University