View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19300_low_4 (Length: 242)
Name: NF19300_low_4
Description: NF19300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19300_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 25772320 - 25772106
Alignment:
| Q |
11 |
tagaaaaggttaccctatccaaaagtgggccacaaccacagtgtgtctgccgcttgattagaaaaataatccatcaccgcccgcctaacctcggttggag |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25772320 |
tagaaaaggttacgctatccaaaagtgggccacaaccacagtgtgtctgccacttgattagaaaaataatccatcaccgcccgcctaacctaggttggag |
25772221 |
T |
 |
| Q |
111 |
actccacccaaacannnnnnnaccttaagttcactatagggagggcaaccaagttgccaatgctctggctatggacaaagcctacctccttttgcctcac |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
25772220 |
actccacccaaaca-ccccccaccttaagttcactatagggagggcaaccaagttgccaatgctcaggctatggacaaagcgtacctccttttgcctcaa |
25772122 |
T |
 |
| Q |
211 |
agtggtgggattcccc |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25772121 |
agtggtgggattcccc |
25772106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University