View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_high_25 (Length: 350)
Name: NF19301_high_25
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 251 - 339
Target Start/End: Complemental strand, 42292882 - 42292794
Alignment:
| Q |
251 |
cttacaaagcgttcgtaggcatgaacatgccctgtaaaaacgacatcaacaagtgcattatagagcaaaccttccattgcagtcttcat |
339 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292882 |
cttacaaagcgttcgtatgcatgaacatgccctgtaaaaacgacatcaacaagtgcattatagagcaaaccttccattgcagtcttcat |
42292794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 42293036 - 42292936
Alignment:
| Q |
20 |
cactggaccacaattgtcacctttatctttataaacccgtgtctaagaaaatnnnnnnngaataattagtatgtgagtgagtgagttatctgcattgtga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42293036 |
cactggaccacaattgtcacctttatctttataaacccgtgtctaagaaaat---aaaagaataattagtat----gtgagtgagttatctgcatcgtga |
42292944 |
T |
 |
| Q |
120 |
tttcaacc |
127 |
Q |
| |
|
|||||||| |
|
|
| T |
42292943 |
tttcaacc |
42292936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University