View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_high_52 (Length: 234)
Name: NF19301_high_52
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_high_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 41871089 - 41871149
Alignment:
| Q |
12 |
tgagatgaagttgagaatcatgaaagacaatagagccatgattagtgatgaactgataatg |
72 |
Q |
| |
|
||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41871089 |
tgagaagaagttgagaattatgaaaaacaatagagccatgattagtgatgaactgataatg |
41871149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University