View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_high_56 (Length: 219)
Name: NF19301_high_56
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_high_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 202
Target Start/End: Original strand, 46655139 - 46655327
Alignment:
| Q |
14 |
attctcagtgacatggttcaggcaaaggcactgatgtagtggaggttaggcttgaccacgtcacagattttcaacctccccgtgaccttcaaaccatcct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
46655139 |
attctcagtgacatggttcaggcaaaggcactgatgtagtggaggttaagcttgaccacataacaaattttcaacctcgccgtgaccttcaaaccatcct |
46655238 |
T |
|
| Q |
114 |
gatcaccaataaactgttgcccattcttattgtttataggcgaggtttaaaatcttgtgatttctgaaccattatgattatattcaagt |
202 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46655239 |
gatcactaataaaccgttgcccattcttattgtttataggtgaggtttaaaatcttgtgatttctgaaccattgtgattatattcaagt |
46655327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University