View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19301_high_57 (Length: 216)

Name: NF19301_high_57
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19301_high_57
NF19301_high_57
[»] chr1 (1 HSPs)
chr1 (18-202)||(33718933-33719117)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 33718933 - 33719117
Alignment:
18 gatatctcaacatatgttttttcatacacaccgaccagacattgaaccctggaccagttggctagggaaaccaagaatctagcacttgtgacattatttt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||| ||    
33718933 gatatctcaacatatgttttttcatacacaccgaccagacattgaaccctggaccaattggcaaaggaaaccaagaatctagcacttgtgacattatatt 33719032  T
118 gatatttaaaacagcagaagtccacttacttttcatatgctcccttcctgtacttgtcagcttgaaatacttttgctcctctgtg 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
33719033 gatatttaaaacagcagaagtccacttacttttcatatgctcccttcctgtacttgtcagcttgaaatacttttgctcctttgtg 33719117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University