View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_low_31 (Length: 319)
Name: NF19301_low_31
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 52026498 - 52026780
Alignment:
| Q |
20 |
gtaaaaccctcgcaaacacaaacaaactcctcacttgtttcgaccaattcattacaaatatgattgcttttcactgtgaattgaacattctgacatgttg |
119 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52026498 |
gtaaaaccctcgcaaacacacacacactcctcacctgtttcgatcaattcattacaaatatgcttgcttttcactgtgaattgaacattctgacatgttg |
52026597 |
T |
 |
| Q |
120 |
gtatgcgaggggcaaccccttacaaaaccctcggggcaaaatcaacttaaattatgttcaacgctcttcgtcctcattcatccatcataaaattttaaaa |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52026598 |
gtatgcgaggggcaaccccttgcaaaaccctcggggcaaaatcagcttaaattatgttcaacgctcttcgtcctcattcatccatcataaatttttaaaa |
52026697 |
T |
 |
| Q |
220 |
tgacatatttctttcttatcatatgttttctttcttcctccaatttccttcatagtactttttctcattatttgactaagaataa |
304 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52026698 |
tgacatagttctttcttgtc--atgttttctttcttcctccaatttccttcatagtactttttctcattatttgactaagaataa |
52026780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University