View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_low_33 (Length: 318)
Name: NF19301_low_33
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 11 - 303
Target Start/End: Complemental strand, 7148586 - 7148294
Alignment:
| Q |
11 |
taatacttggaggaagattcatgattttcctcatggtgtttcaccttaccaaaattcatctgggaaatttgttagtggtacactcaattgggcttctaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7148586 |
taatacttggaggaagattcatgattttcctcatggtgtttcaccttaccaaaattcatctgggaaatttgttagtggtacactcaattgggcttctaat |
7148487 |
T |
|
| Q |
111 |
tactcaattggttcaagttcattttggactattgtttctttggatttggagaaggaaacttatagggaagtgcttccacctgattatgaaaaggaagagt |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7148486 |
tactcaattggttcaagttctttttggactattgtttctttggatttggagaaggaaacttatagggaagtgcttccacctgattatgaaaaggaagagt |
7148387 |
T |
|
| Q |
211 |
gttcaactcctagtttgagtgtgctaaagggttgtctttgcatgaattatgattacaaaaagactgattttgttgtatggttgatgaaggatt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7148386 |
gttcaactcctagtttgagtgtgctaaagggttgtctttgcatgaattatgattacaaaaagactgattttgttgtatggttgatgaaggatt |
7148294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University