View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_low_34 (Length: 305)
Name: NF19301_low_34
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 294
Target Start/End: Original strand, 41095442 - 41095720
Alignment:
| Q |
17 |
aataatgtttaagttgttgccactaatgctagtaatacatccaagttggatgcacccaacctagtttctggcattacatcgatcgagataactttgaaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41095442 |
aataatgtttaagttgttgccactaatgctagtaatacatccaagttggatgcacccaacctagtttctggcattacatcgatcgagataactttgagca |
41095541 |
T |
 |
| Q |
117 |
agatccacacatcgttgcatatatgaaatgttggtcttcacatgataatcacaccacaatcatgtgtaaatcatatagaatgaccataataaactttcga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41095542 |
agatccacacatcgttgcatatatgaaatgttggtcttcacgtgataatcacaccacaatca--tgtaaatcatatagaatgaccataataaacgttcga |
41095639 |
T |
 |
| Q |
217 |
tcaacatataacttgttattgtccctc---nnnnnnnnntataacttgtttattaatttaccaacttttattaacattcat |
294 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41095640 |
tcaacatataacttgttattgtccctcaaaaaaaaaaaatataacttgtttattaatttaccaacttttattaacattcat |
41095720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University