View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_low_38 (Length: 273)
Name: NF19301_low_38
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 84 - 266
Target Start/End: Original strand, 40467131 - 40467313
Alignment:
| Q |
84 |
caatttggattgaaacttatattctagtatattttgctcttttaaaaaatagttttgaaacttattctcttattgcactcgtgatccacccatagctagt |
183 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40467131 |
caattaggattgaaacttatattctagtatattttgctcttttaaaaaatagttttgaaacttattctcttattgcactcgtgatccacccatagctagt |
40467230 |
T |
 |
| Q |
184 |
cttgaaacttttgtcacacactttggaacgtactgtatgtgatgagctcgtgaaaccctatcttgttccacccatattcttcg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40467231 |
cttgaaacttttgtcacacactttggaacgtactgtatgtgatgagctcgtgaaaccctatcttgttccacccatattgttcg |
40467313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 40467030 - 40467072
Alignment:
| Q |
1 |
ttatatactcaatactttcaagttttggcaaaatgttaataac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40467030 |
ttatatactcaatactttcaagttttggcaaaatggtaataac |
40467072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University