View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_low_45 (Length: 247)
Name: NF19301_low_45
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 40353542 - 40353778
Alignment:
| Q |
1 |
cacaccttggtctatcattatcttactcaacattatcggataatagatcatatttatgttactcaaattacccataactgtgtccaaaaacagcagtgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40353542 |
cacaccttggtctatcattatcttactcaacattattggataatagatcatatttatgttactcaaattacacataactgtgtccaaaaacagcagtgac |
40353641 |
T |
 |
| Q |
101 |
aaatttacctttttgatctttagagtgttgtaaatacaaaagttgtgtaggtttgagactcggtattcatcttggtcacattgtatgaatatcttctaga |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
40353642 |
aaatttacctttttgttctttagagtgttgtaaatacaaaagttgtgtaggtttgagactcggcattcatcttggtcacattgtatgaatatcttcttga |
40353741 |
T |
 |
| Q |
201 |
taaagtaataaagaagaccatgatttgctttcatctg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40353742 |
taaagtaataaagaagaccatgatttgctttcatctg |
40353778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University