View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19301_low_51 (Length: 236)

Name: NF19301_low_51
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19301_low_51
NF19301_low_51
[»] chr8 (1 HSPs)
chr8 (1-222)||(39345986-39346207)


Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 39346207 - 39345986
Alignment:
1 catagggcaccccaaaaaatgagagcatcaacaagaaggaacaaaatttcaacgaaaatcatgtcatgtcacgatctcattgattttgccaatggcaatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
39346207 catagggcaccccaaaaaatgagagcatcaacaagaaggaacaaaatttcaatgaaaatcatgtcatgtcacgatctcattgattttgccaatggcaatt 39346108  T
101 cactttcatgtgaggcaacagaagataccctattcaattgagcagcaccaacaccttttggtgattgagttgcaacctcaacatctccattcctaggtgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39346107 cactttcatgtgaggcaacagaagataccctattcaattgagcagcaccaacaccttttggtgattgagttgcaacctcaacatctccattcctaggtgt 39346008  T
201 agttgaaccaccccaatttcct 222  Q
    ||||||||||||||||||||||    
39346007 agttgaaccaccccaatttcct 39345986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University