View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19301_low_54 (Length: 234)

Name: NF19301_low_54
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19301_low_54
NF19301_low_54
[»] chr3 (1 HSPs)
chr3 (12-72)||(41871089-41871149)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 41871089 - 41871149
Alignment:
12 tgagatgaagttgagaatcatgaaagacaatagagccatgattagtgatgaactgataatg 72  Q
    ||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||    
41871089 tgagaagaagttgagaattatgaaaaacaatagagccatgattagtgatgaactgataatg 41871149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University