View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19301_low_55 (Length: 229)
Name: NF19301_low_55
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19301_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 42 - 227
Target Start/End: Complemental strand, 14193455 - 14193273
Alignment:
| Q |
42 |
tcagtgaaactggtatccatatgttctgctcccttagagatggtgctaaatagtgtcatcaaatcttccttgctcctcctgtcacacccatccagtacta |
141 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
14193455 |
tcagtgaaactggaatccatatgttctgctccctgagagatggtgctaaatagtgtcatcaaatctttcctgctcct---gtcacacccatccagtacta |
14193359 |
T |
 |
| Q |
142 |
taacccctgtttcttgaagcaatccaatgtcagattcacagcatatcaaacctttgaagaaaagagcataggatgtatatttgcat |
227 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14193358 |
taacccctttttcttgaagcaatccaatgtcagattcacagcatatcaaacctttgaagaaaagagcataggatgtatatttgcat |
14193273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 156 - 227
Target Start/End: Complemental strand, 4591540 - 4591469
Alignment:
| Q |
156 |
tgaagcaatccaatgtcagattcacagcatatcaaacctttgaagaaaagagcataggatgtatatttgcat |
227 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||||| || |||||||| ||||||||||| ||||||||| |
|
|
| T |
4591540 |
tgaagcaattcaatgtcatgttcacaacatatcaaaccattaaagaaaagtgcataggatgtgtatttgcat |
4591469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 141 - 229
Target Start/End: Complemental strand, 4555254 - 4555166
Alignment:
| Q |
141 |
ataacccctgtttcttgaagcaatccaatgtcagattcacagcatatcaaacctttgaagaaaagagcataggatgtatatttgcattt |
229 |
Q |
| |
|
||||||||| |||| ||||||| | |||||||| ||||| ||||||||||| || |||||||| |||||||| || ||||||||||| |
|
|
| T |
4555254 |
ataacccctttttcctgaagcatttcaatgtcatgctcacaacatatcaaaccattaaagaaaagtgcataggaagtgtatttgcattt |
4555166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 4621077 - 4621017
Alignment:
| Q |
151 |
tttcttgaagcaatccaatgtcagattcacagcatatcaaacctttgaagaaaagagcata |
211 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
4621077 |
tttcttgaagtaattcaatgtcatgctcacagcatatcaaaccattgaaaaaaagtgcata |
4621017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University