View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19301_low_60 (Length: 216)

Name: NF19301_low_60
Description: NF19301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19301_low_60
NF19301_low_60
[»] chr8 (1 HSPs)
chr8 (20-199)||(32534727-32534906)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 32534906 - 32534727
Alignment:
20 agtgaaaacttcgtactgataacatgataaccaaaaagaaaattgaatctgaaatagtatgagacaaacaaatattcaaaaatttgcacttaatagaaca 119  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32534906 agtgaaaactttgtactgataacatgataaccaaaaagaaaattgaatctgaaatagtatgagacaaacaaatattcaaaaatttgcacttaatagaaca 32534807  T
120 tacacaaagttagaactatggtttctggtatttgtgatgattgaagagaaagtcagcactatggtttgtagacttgtagt 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32534806 tacacaaagttagaactatggtttctggtatttgtgatgattgaagagaaagtcagcactatggtttgtagacttgtagt 32534727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University