View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19302_low_7 (Length: 267)
Name: NF19302_low_7
Description: NF19302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19302_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 16 - 252
Target Start/End: Original strand, 5584517 - 5584756
Alignment:
| Q |
16 |
atgactcagagattagtcagcaggcacgagttgctgcaacataatccattgtaagcgaatatgacggaataagaata-tttaatccaaggcaaaggcaac |
114 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5584517 |
atgactcagagactagtcagcaggcacgagttgctgcaacataatccattgtaagcgaatatgacggaataagaatattttaatctaaggcaaaggcaac |
5584616 |
T |
|
| Q |
115 |
tagtaagcactaataatacgagagtataccacccctgatg-tacgagagtatacaatttcttagagatt-actcagttgataaatatattttataaaggt |
212 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
5584617 |
ttgtaagcactaataatacgagagtattccacccctaatgatacgagagtatacaatttcttagagattaacttagttgataaatatattttataaaggt |
5584716 |
T |
|
| Q |
213 |
cggtattcaaacccccaaacaactcatttatctaccttaa |
252 |
Q |
| |
|
|||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
5584717 |
cggtattcaaactctcagacaactcatttatctaccttaa |
5584756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University