View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19303_high_39 (Length: 208)
Name: NF19303_high_39
Description: NF19303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19303_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 33916376 - 33916546
Alignment:
| Q |
20 |
tcttgagccttgctccaaattagggtttcttgagaaatgtgcctcatttgcattctgatttctgcttggttttatagtgcaattgttctggataattgtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33916376 |
tcttgagccttgctccaaattagggtttcttgagaaatgtgcctcatttgcattctgatttctgcttggttttatagtgcaattgttctggataattttg |
33916475 |
T |
 |
| Q |
120 |
gtatggaaatggtactgaaattagggtttttggaatgttggcctaatctggaaattccatagtacatttct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33916476 |
gtatggaaatggtactgaaattagggtttttggaatgttggcctaatctggaaattgcatagtacatttct |
33916546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University