View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19303_high_40 (Length: 204)
Name: NF19303_high_40
Description: NF19303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19303_high_40 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 183
Target Start/End: Original strand, 53584 - 53750
Alignment:
| Q |
16 |
ataattcttgtagtggggtggtctcatctcggtttaaatagatagagtactacttgtacttcatctattcctttaagtctagtattaattgtacatcatt |
115 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53584 |
ataactcttgtagtggg-tggtctcatctcggtttaaatggatagagtactacttgtacttcatctattcctttaagtctagtattaattgtacatcatt |
53682 |
T |
 |
| Q |
116 |
tttaactatgattcaacaaattttaatttgttgaatcatataagaaaacatgttttgtttgctgaggg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53683 |
tttaactatgattcaacaaattttaatttgttgaatcatataagaaaacatgttttgtttgctgaggg |
53750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University