View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19303_low_29 (Length: 274)
Name: NF19303_low_29
Description: NF19303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19303_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 2817704 - 2817483
Alignment:
| Q |
1 |
cacaagtctctctatcccttcactacttcttcttacggttcaagccttttctccattgttattttttattatcatcatttctttcttgcttttactaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817704 |
cacaagtctctctatcccttcactacttctt---acggttcaagccttttctccattgttattttttattatcatcatttctttcttgcttttactaatt |
2817608 |
T |
 |
| Q |
101 |
tcatgttcatggattctacatttttgtatacaatttnnnnnnnnnnnntatagtgtggcgacgagccgaattgatagagttttcctatcggaagagtggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817607 |
tcatgttcatggattctacatttttgtatacaatttcacacacacacatatagtgtggcgacgagccgaattgatagagttttcctatcggaagagtggg |
2817508 |
T |
 |
| Q |
201 |
tgaatatgtggggaagtctgtctct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2817507 |
tgaatatgtggggaagtctgtctct |
2817483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 225
Target Start/End: Complemental strand, 26477704 - 26477646
Alignment:
| Q |
167 |
cgaattgatagagttttcctatcggaagagtgggtgaatatgtggggaagtctgtctct |
225 |
Q |
| |
|
||||||||||| || ||| | | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26477704 |
cgaattgatagggtgttcattttggacgagtgggtgaatatgtggggaagtctgtctct |
26477646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 214
Target Start/End: Original strand, 24567600 - 24567646
Alignment:
| Q |
168 |
gaattgatagagttttcctatcggaagagtgggtgaatatgtgggga |
214 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
24567600 |
gaattgatagagttgttgtatcggaagagtgggtgaatttgtgggga |
24567646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University