View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19303_low_38 (Length: 211)
Name: NF19303_low_38
Description: NF19303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19303_low_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 36457623 - 36457820
Alignment:
| Q |
14 |
cctgtggttcatctgctgcagcataatgtgtctttatggggagtgaaaaacaaaaggctcgctcggtctgttgttgtggtgagcggttgtttgatctcta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36457623 |
cctgtggttcatctgctgcagcataatgtgtctttatggggagtgaaaaacaaaaggctcgctcggtctgttgttgtggtgagcggttgtttggtctcta |
36457722 |
T |
 |
| Q |
114 |
tggattgctagaaataatataatttttatggacagtattcctaatgtgttcaatctcttagttggaaatggatgtcatcgaaaataggtagcagaccg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
36457723 |
tggattgctagaaataatataatttttatggacagtattcctaatgtgttcaatctcttagttggaaatgaatgtcgtcgaaaataggtagcagaccg |
36457820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 82 - 161
Target Start/End: Complemental strand, 11628456 - 11628377
Alignment:
| Q |
82 |
tgttgttgtggtgagcggttgtttgatctctatggattgctagaaataatataatttttatggacagtattcctaatgtg |
161 |
Q |
| |
|
||||||||| | ||| ||||||||| ||||||| ||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
11628456 |
tgttgttgttgggagaggttgtttggtctctatatattgctagaaataatataatttttatggacaatatttctaatgtg |
11628377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University