View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19304_high_2 (Length: 391)

Name: NF19304_high_2
Description: NF19304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19304_high_2
NF19304_high_2
[»] chr5 (3 HSPs)
chr5 (4-82)||(43194323-43194401)
chr5 (244-370)||(43194044-43194170)
chr5 (10-82)||(43194495-43194567)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 8e-37; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 4 - 82
Target Start/End: Complemental strand, 43194401 - 43194323
Alignment:
Q  4 gtattttgagattgaatcgttcaggtgacttaacttagtttgttttggttaggttacctgaacggttcaatcttaactt 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43194401 gtattttgagattgaatcgttcaggtgacttaacttagtttgttttggttaggttacctgaacggttcaatcttaactt 43194323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 244 - 370
Target Start/End: Complemental strand, 43194170 - 43194044
Alignment:
Q  244 agattgaatcggttgatgacctaaccaatgattatatctaaactgaagtttgttaaatatttgatgttattaaaattannnnnnnnnnnnnaattgatat 343  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||             |||||| ||    
T  43194170 agattgaatcggttgatgacctaaccaatgattatatctaaactgaagtctgttaaatatttgatgttattaaaattatttttatttttttaattgagat 43194071  T
Q  344 ttgatttggttcttggtgttgatgatg 370  Q
    |||||||||||||||||||| ||||||    
T  43194070 ttgatttggttcttggtgttaatgatg 43194044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 43194567 - 43194495
Alignment:
Q  10 tgagattgaatcgttcaggtgacttaacttagtttgttttggttaggttacctgaacggttcaatcttaactt 82  Q
    |||||||||||||||| | |||| |||   |||||||||||||||||||| ||||||| ||||||||| ||||    
T  43194567 tgagattgaatcgttctgatgacctaatcgagtttgttttggttaggttatctgaacgattcaatcttgactt 43194495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University