View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19305_high_46 (Length: 271)
Name: NF19305_high_46
Description: NF19305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19305_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 42417444 - 42417189
Alignment:
| Q |
1 |
tctttaggaccttctatccaaagtttcattagcctgtcattaaagaatttaatgaattagttattttgttgggcgaatttggattcaatatagctgcagt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42417444 |
tctttaggaccatctatccaaagtttcattagcctgtcattaaagaatttaatgaattgattattttgttgggcgaatttcgattcaatatagctgcagt |
42417345 |
T |
 |
| Q |
101 |
atgatgttgcaacggtagagagtccaatttcgtgtcgctaaggttttttaaaaaatggtttgcagcaccaagataaaagatcacaatgtaactacaattg |
200 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
42417344 |
atgatgttgcaaccgtagagagaccaattttgtgttgctaaagttttttaaaaaatggtttgcagcaccaaggtaaaagatcacaatgtgactacaattg |
42417245 |
T |
 |
| Q |
201 |
agttgcatcccatttaacatcaagtattacaagtggcag--aaataatgcaaaataagt |
257 |
Q |
| |
|
||| ||| |||||||| |||| |||||||||| |||| ||| |||||||||||||| |
|
|
| T |
42417244 |
agt---atcacatttaacctcaattattacaagttgcagaaaaaaaatgcaaaataagt |
42417189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University