View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19305_high_59 (Length: 236)
Name: NF19305_high_59
Description: NF19305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19305_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 28 - 73
Target Start/End: Original strand, 53098121 - 53098166
Alignment:
| Q |
28 |
cagaggaatgatcaacggcattgcattcattgaaaacctacaaaat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53098121 |
cagaggaatgatcaacggcattgcattcattgaaaacctacaaaat |
53098166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 53098223 - 53098265
Alignment:
| Q |
176 |
cgaacctttttgggatttgatttatgagaatcggagagattgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53098223 |
cgaacctttttgggatttgatttatgagaatcggagagattgc |
53098265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University