View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19305_low_20 (Length: 443)
Name: NF19305_low_20
Description: NF19305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19305_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 38 - 435
Target Start/End: Original strand, 34685318 - 34685711
Alignment:
| Q |
38 |
ttatagggagatatttatttatgttagtatttttgggttttcgagcattacctaccggtccacccggtcgatccgaggcggtttatatacaaacttgagc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34685318 |
ttatagggagatatttatttatgttagtttttttgggttttcgagcattacctaccggtccacccggtcgatcc----------------aaacttgagc |
34685401 |
T |
|
| Q |
138 |
tccacgtaacctatttcaagagaccttccgtttcttctcccgttctgttcatcgccgccgccgc------aatatatttactatgtgtggagagattgaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34685402 |
tccacgtaacctatttcaagagaccttccgtttcttctcccgttctgttcatagccgccgccgccgctgcaatatatttactatgtgtggagagattgaa |
34685501 |
T |
|
| Q |
232 |
agctgcaagagcagcagttatgagaaagaggatgaagtgattgttggcaatggcaacgccaaatctattcaaatgctcagaaatctcatcataaagcctc |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685502 |
agctgcaagagcagcagttatgagaaagaggatgaagtgattgttggcaatggcaacgccaaatctattcaaatgctcagaaatctcatcataaagcctc |
34685601 |
T |
|
| Q |
332 |
gtctcttccctagtcgggcaaatagggtgagtgcttgttttcccttctttgctgg------ttattcttattcttacttcttttttcgttgctttcagct |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685602 |
gtctcttccctagtcgggcaaatagggtgagtgcttgttttcccttatttgctggttattcttattcttattcttacttcttttttcgttgctttcagct |
34685701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University