View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19305_low_42 (Length: 312)
Name: NF19305_low_42
Description: NF19305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19305_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 295
Target Start/End: Original strand, 7097070 - 7097355
Alignment:
| Q |
11 |
tgagatgaactgtaagaaaagtcaagcttaatctaacataatcattatcgggctcccttcgtgacccaacaactcctagtggttgtgaaaagctatctct |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7097070 |
tgagaagaactgtaagaaaagtcaagcttaatctaacataatcattatcgggctcccttcgtgacccaacaactcctagtggttgtgaaaagctatctct |
7097169 |
T |
 |
| Q |
111 |
ctactttgttttgaaaattttgttgttctactaaatcaataaatttttactagttctactaagcactcgcaagcaaacaaga-nnnnnnnnaaaatttcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
7097170 |
ctactttgttttgaaaattttgttgttctactaaatcaataaatttttactagttctactaagcactcacaagcaaacaagattttttttttaaatttcg |
7097269 |
T |
 |
| Q |
210 |
gcgattgaatcttggctgcagcatctagttttctgagtgtctgcaaccgtaatacggtcacataagccacatttgacagcagttct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7097270 |
gcgattgaatcttggctgcagcatctagttttctgagtttctgcaaccgtaatacggtcacataagccacatttgacagcagttct |
7097355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 7584008 - 7583944
Alignment:
| Q |
108 |
tctctactttgttttgaaaattttgttgttctactaaatcaataaatttttactagttctactaa |
172 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||| ||||| ||||||||| ||||||||| |
|
|
| T |
7584008 |
tctctactttgttttgaaaatttaaatgttatagtaaaccaatatgtttttactaattctactaa |
7583944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University