View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19305_low_43 (Length: 301)
Name: NF19305_low_43
Description: NF19305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19305_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 290
Target Start/End: Complemental strand, 13110954 - 13110678
Alignment:
| Q |
21 |
atcttcatattcgagtacaaagat---aaggtcggttaatgcaaaagttggaagnnnnnnncacgcacacactagcaacaactaaaaaagttcataaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13110954 |
atcttcatattcgagtacaaagatgataaggtcgattaatgcaaaagttggaagaaaaaa-cacgcacacgctagcaacaactaaaaaagttcataaaga |
13110856 |
T |
|
| Q |
118 |
atcattttaattgataaacaatggtgaattatttacatagtagacatattctcatttagaaaa-----ctcaattatttacatttagacatattctcatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13110855 |
atcattttaattgataaacaatggtgaattatttacatagtagacatattctcatttagaaaaaaaaactcaattatttacatttagacatattctcatt |
13110756 |
T |
|
| Q |
213 |
tattcttatattcttgaatttgagaattaatttcacattaaattttttgaatgaaagttctggtttgtctgtgctcct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
13110755 |
tattcttatattcttgaatttgagaattaatttcacattaaatattttgaatgaaagttctggtttgtttgtgatcct |
13110678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University