View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19305_low_53 (Length: 258)
Name: NF19305_low_53
Description: NF19305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19305_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 14784624 - 14784399
Alignment:
| Q |
17 |
tgtgtgatgtaaaatgtccttgtcaacattctgagagagaattaatatttgactatgcattaatcttgaaaatggagagaattaaagtgacatttttgaa |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14784624 |
tgtgtgatgtaaaatgtcctggtcaacattctcagagagaattaatatt-gactatgcattaatcttgaaaatggagagaattaaggtgacatttttgaa |
14784526 |
T |
 |
| Q |
117 |
acaatgggattatatagagataaatttggtgacttttgtttatatttgatgtgagaaatttatttatttttacttataattaaggctagaggagcataac |
216 |
Q |
| |
|
| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14784525 |
agaatggg-ttatatagagataaatttggtgacttttgtttatatttgatgtgagaaatttatttatttttacttataattaatgctagaggagcatatt |
14784427 |
T |
 |
| Q |
217 |
gtcgatgtaaatattttgatatttgaat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14784426 |
gtcgatgtaaatattttgatatttgaat |
14784399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University