View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19306_high_24 (Length: 236)
Name: NF19306_high_24
Description: NF19306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19306_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 41795112 - 41795328
Alignment:
| Q |
1 |
cctagttttcgttggtttaactaaatctttctccaactcttctagtgatgatgatgatgataaaccttccaatattgaagaaaaagaagaagaaatttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795112 |
cctagttttcgttggtttaactaaatctttctccaactcttctagtgat---gatgatgataaaccttccaatattgaagaaaaagaagaagaaatttgt |
41795208 |
T |
|
| Q |
101 |
tcacggtctcatgttcttgatgttgaggtgaacgagccattgttggagagagaagttgagatgagaactaatgacgcagatgaacacagtgctgcagtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
41795209 |
tcacggtctcatgttcttgatgttgaggtgaatgagccattgttggagagagaagttgagatgagaactaatgaagcagatgaacacaatgctgcagtag |
41795308 |
T |
|
| Q |
201 |
aggaaaaagaagtacaagaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41795309 |
aggaaaaagaagtacaagaa |
41795328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 41760264 - 41760314
Alignment:
| Q |
5 |
gttttcgttggtttaactaaatctttctccaactcttctagtgatgatgat |
55 |
Q |
| |
|
||||| |||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
41760264 |
gtttttgttggtttaactaaatctttttctgcctcttctagtgatgatgat |
41760314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University