View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19306_high_26 (Length: 225)
Name: NF19306_high_26
Description: NF19306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19306_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 28872850 - 28873047
Alignment:
| Q |
11 |
cgaagaatatagcatggttcgtcgaatagtagggtttagtcccagtccttttgataggtaaaggtcaccgccgggtagcctagcttcactggatgaaaca |
110 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28872850 |
cgaaaaatagagcatggttcgtcgaatagtagggtttagtcccagtccttttgataggtaaaggtcaccgccgggtagcctagcttcactggatgaaaca |
28872949 |
T |
|
| Q |
111 |
taaaccacatgagttatgtctgataaagatccaccccaattctttatgcaaacctgggaagcctcgattgccatttgcgtcaccgcctcgttacatat |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28872950 |
taaaccacatgagttatgtccgataaagatccaccccaattctttatgcaaacctgggaagcctcgattgccatttgcgtcaccgcctcgttacatat |
28873047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 28884792 - 28884844
Alignment:
| Q |
120 |
tgagttatgtctgataaagatccaccccaattctttatgcaaacctgggaagc |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||| || |||||||||| |||||||| |
|
|
| T |
28884792 |
tgagttatgtctgataaagatctaccccagttttttatgcaaatttgggaagc |
28884844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University