View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19306_low_16 (Length: 304)
Name: NF19306_low_16
Description: NF19306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19306_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 6e-37; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 101 - 200
Target Start/End: Complemental strand, 34361423 - 34361320
Alignment:
| Q |
101 |
gaacacaaagcaagcatg----agtagttttatggagtaagttttgtattaaaaaccattggatgcatgtgtctgggtctcggatacgtgtgaacataat |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
34361423 |
gaacacaaagcaagcatgcattagtagttttatggagtaagttttgtattaaaaaccattggatgcatgtgtctgggtgtcggataggtgtgaacataat |
34361324 |
T |
 |
| Q |
197 |
aaac |
200 |
Q |
| |
|
|||| |
|
|
| T |
34361323 |
aaac |
34361320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 244 - 304
Target Start/End: Complemental strand, 34361273 - 34361213
Alignment:
| Q |
244 |
tctggatcaatggcagttgtgaaggtgtaaggagtaacacaggcacctgatggtaaacatg |
304 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34361273 |
tctggatcaatggcagttgtgaaggtataaggagtaacacaggcacctgatggtaaacatg |
34361213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 34361470 - 34361418
Alignment:
| Q |
1 |
gtagagacactaaaattactctttcatcaatatgaacatccattagagaacac |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34361470 |
gtagagacactaaaattactctttcatcaatatgaacagccattagagaacac |
34361418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 240 - 300
Target Start/End: Original strand, 12118356 - 12118416
Alignment:
| Q |
240 |
cttctctggatcaatggcagttgtgaaggtgtaaggagtaacacaggcacctgatggtaaa |
300 |
Q |
| |
|
||||||| |||||||||||||||||| ||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
12118356 |
cttctctagatcaatggcagttgtgatggtataaggaggaacacaggcacgtgatggtaaa |
12118416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 240 - 300
Target Start/End: Complemental strand, 37167052 - 37166992
Alignment:
| Q |
240 |
cttctctggatcaatggcagttgtgaaggtgtaaggagtaacacaggcacctgatggtaaa |
300 |
Q |
| |
|
||||||| |||||||||||||||||| ||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
37167052 |
cttctctagatcaatggcagttgtgatggtataaggaggaacacaggcacgtgatggtaaa |
37166992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University