View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19306_low_30 (Length: 223)
Name: NF19306_low_30
Description: NF19306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19306_low_30 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 52 - 223
Target Start/End: Complemental strand, 28930192 - 28930021
Alignment:
| Q |
52 |
cgtgtcatcggcttatatgctgctatgcaatttcaatgaaaatgagctggacagggatttggtttaaaacctggaaattgaacacatcagagtgagttag |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28930192 |
cgtgtcatcggcttatatgctgctatgcaatttcaatgaaaatgagctggacagggatttggtttaaaacctggaaattgaacacatcagagtgagttag |
28930093 |
T |
 |
| Q |
152 |
aagtttccactggaatctggatggctaagcatgatcgcattctcactaatttataagaagagtaagatgatg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28930092 |
aagtttccactggaatctggatggctaagcatgatcgtattctcactaatttataagaagagtaagatgatg |
28930021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 28930256 - 28930210
Alignment:
| Q |
6 |
tgccccatctctgtcatggtttggtcaagaggatctggaatagaccc |
52 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28930256 |
tgccccacctctgtcatggttcggtcaagaggatctggaatagaccc |
28930210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University