View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19307_high_23 (Length: 256)
Name: NF19307_high_23
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19307_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 7742611 - 7742662
Alignment:
| Q |
187 |
catgcatgcaggcttcattatcggtcctgatgtgcaagacgaagatgataatact |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7742611 |
catgcatgcaggcttcattatcggt---gatgtgcaagacgaagatgataatact |
7742662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 40864400 - 40864448
Alignment:
| Q |
191 |
catgcaggcttcattatcggtcctgatgtgcaagacgaagatgataata |
239 |
Q |
| |
|
||||||||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
40864400 |
catgcaggcttcattgttgggcctgatgtgcaagacgaagatgataata |
40864448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 40863619 - 40863671
Alignment:
| Q |
48 |
aaggtttctgctttgaatttctttgatgaagaggctgatgttgattctgatga |
100 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
40863619 |
aaggtttccgcttcaaatttctttgacgaagaggctgctgttgattcggatga |
40863671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University