View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19307_low_16 (Length: 346)
Name: NF19307_low_16
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19307_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 172 - 314
Target Start/End: Original strand, 10419767 - 10419909
Alignment:
| Q |
172 |
tttagaaaaatattgtcaccaaatttatacaagttcactaaagatgtgataaatgttgtataaacaaaggacactgtcaaaattttgatagaaatagttt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10419767 |
tttagaaaaatattgtcaccaaatttatacaagttcactaaagatgtgataaatgttgtataaacaaaggacactgtaaaaattttgatagaaatagttt |
10419866 |
T |
|
| Q |
272 |
aacttagcattttgaactattttgtgaaaatggtcaaaatgta |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10419867 |
aacttagcattttgaactattttgtgaaaatggtcaaaatgta |
10419909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University