View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19307_low_18 (Length: 339)
Name: NF19307_low_18
Description: NF19307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19307_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 133 - 328
Target Start/End: Complemental strand, 42095160 - 42094965
Alignment:
| Q |
133 |
ttatgtccgtgtttatgccactcttattgaggtgttttgtgaggtggggtgtaatttgtggttagtgaaagtaaatgtgtgttttgtttttggatccggt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
42095160 |
ttatgtccgtgtttatgccactcttattgaggtcttttgtgaggtggggtgtaatttgtggttagtgaaagtaaaggtgtgctttgtttttggatccggt |
42095061 |
T |
|
| Q |
233 |
caacgactataaacaaaaatatagaattttattgagattaaattctcctattaaaatttaaatttttgttttactcttactttatatgatatgatg |
328 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42095060 |
caacgactaaaaacaaaactatagaattttattgagattaaattctcctattaaaatttaaatttttgttttactgttactttatatgatatgatg |
42094965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 42095236 - 42095157
Alignment:
| Q |
16 |
agagtatcactgtttctcttggtttttggtttggttttattgtgcatgcatggaagttatttcgtgttacaccagtttat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42095236 |
agagtatcactgtttctcttggtttttggtttggttttattgtgcatgcatggaagttatttcgtgttacaccagtttat |
42095157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University